Biology:LRRC24

From HandWiki
Short description: Protein-coding gene in the species Homo sapiens


A representation of the 3D structure of the protein myoglobin showing turquoise α-helices.
Generic protein structure example


Leucine rich repeat containing 24 is a protein that, in humans, is encoded by the LRRC24 gene.[1] The protein is represented by the official symbol LRRC24, and is alternatively known as LRRC14OS.[2] The function of LRRC24 is currently unknown. It is a member of the leucine-rich repeat (LRR) superfamily of proteins.

Gene

In humans, LRRC24 is located on Chromosome 8 (8q24.3). The gene spans approximately 4.66 kb on the opposite strand.[1] LRRC24 is composed of five exons, and only a single gene isoform has been identified.[1]

GeneCards Genomic View for LRRC24 gene[2]

Protein

General features

LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide.[1][3] The mature form of the protein has a molecular weight of 52.9 kDa.[4] The isoelectric point of the mature human protein is 7.98[5] The protein is largely composed of alpha helices.[6]

Domains

LRRC24 is a single-pass transmembrane protein. The protein consists of six leucine-rich repeats and an immunoglobulin-like domain.[1][7]

Feature Position(s) Description
Signal Peptide 1-23 [8]
Domain 24-50 Leucine rich repeat N-terminal domain (LRRNT)[9][10]
Repeat 51-72 Leucine rich repeat 1 (LRR 1)[9][10]
Repeat 75-96 LRR 2[9][10]
Repeat 99-120 LRR 3[9][10]
Repeat 123-144 LRR 4[9][10]
Repeat 147-168 LRR 5[9][10]
Repeat 171-192 LRR 6[9][10]
Domain 204-257 Leucine rich repeat C-terminal domain (LRRCT)[9][10]
Domain 259-364 Immunoglobulin-like domain (Ig-like)[9][10]
Domain 406-426 Transmembrane domain (TMEM)[11]
Motif 427-436 Arginine-rich motif (ARM)[9]
Diagram of LRRC24. Domains are labelled as predicted;[12] grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator[13]

Localization

LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the cell membrane.

Homology

LRRC24 is conserved in Euteleostomi with the exception of Aves.[1][14] Also, based on sequence homology analysis, distant orthologs of LRRC24 are also conserved in invertebrates of phyla Mollusca and Arthropoda.[1] No human paralogs of LRRC24 have been identified.

An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree[12] and ClustalW.[5][15]

Expression

Microarray and in situ hybridization experiments suggest LRRC24 is primarily expressed within the brain.[16][17][18] Expression is observed to be especially high within the midbrain, neocortex, and tissues of the limbic system, including the hypothalamus and hippocampal formation.[16][18][19]

Interactions

Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. ROBO2 was found to interact with LRRC24.[20][21] ROBO2 is a member of the Roundabout gene family, which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in synaptogenesis, as well as the maintenance of the nervous system in vertebrates.[21]

LRRC24 has also been found to interact with IGFBP7, a known regulator of insulin-like growth factors (IGFs).[21] IGFBP7 is also involved in the stimulation of cell adhesion.

Clinical significance

To date, no study has specifically implicated LRRC24 or the LRRC24 gene with any case of clinical significance.[22]

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human) - Gene - NCBI"]. https://www.ncbi.nlm.nih.gov/gene/441381. 
  2. ↑ 2.0 2.1 "GeneCard". https://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24. 
  3. ↑ "LRRC24 Gene (Protein Coding)". https://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24. Retrieved February 22, 2016. 
  4. ↑ "Methods and algorithms for statistical analysis of protein sequences". Proceedings of the National Academy of Sciences of the United States of America 89 (6): 2002–6. March 1992. doi:10.1073/pnas.89.6.2002. PMID 1549558. Bibcode: 1992PNAS...89.2002B. 
  5. ↑ 5.0 5.1 "IPC - Isoelectric Point Calculator". Biology Direct 11 (1): 55. October 2016. doi:10.1186/s13062-016-0159-9. PMID 27769290. 
  6. ↑ "PELE: Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique". Journal of Chemical Theory and Computation 1 (6): 1304–11. November 2005. doi:10.1021/ct0501811. PMID 26631674. 
  7. ↑ "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". https://www.uniprot.org/uniprot/Q50LG9#family_and_domains. 
  8. ↑ "SignalP 4.0: discriminating signal peptides from transmembrane regions" (in en). Nature Methods 8 (10): 785–6. September 2011. doi:10.1038/nmeth.1701. PMID 21959131. 
  9. ↑ 9.00 9.01 9.02 9.03 9.04 9.05 9.06 9.07 9.08 9.09 "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". https://www.uniprot.org/uniprot/Q50LG9. 
  10. ↑ 10.0 10.1 10.2 10.3 10.4 10.5 10.6 10.7 10.8 "NCBI Conserved Domain Search". https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi?seqinput=NP_001019849.2. 
  11. ↑ "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes". Journal of Molecular Biology 305 (3): 567–80. January 2001. doi:10.1006/jmbi.2000.4315. PMID 11152613. 
  12. ↑ 12.0 12.1 "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human) - Gene - NCBI"]. https://www.ncbi.nlm.nih.gov/gene/441381. 
  13. ↑ SIB Swiss Institute of Bioinformatics. "Prosite MyDomains - Image Creator". http://prosite.expasy.org/cgi-bin/prosite/mydomains/. 
  14. ↑ "HomoloGene - NCBI". https://www.ncbi.nlm.nih.gov/homologene/?term=LRRC24. 
  15. ↑ "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Research 22 (22): 4673–80. November 1994. doi:10.1093/nar/22.22.4673. PMID 7984417. 
  16. ↑ 16.0 16.1 "GDS868 / GATCCATTGCTGAGCTTGCG". https://www.ncbi.nlm.nih.gov/geo/tools/profileGraph.cgi?ID=GDS868:GATCCATTGCTGAGCTTGCG. 
  17. ↑ "GDS3142 / 1433876_at". https://www.ncbi.nlm.nih.gov/geo/tools/profileGraph.cgi?ID=GDS3142:1433876_at. 
  18. ↑ 18.0 18.1 "GDS3917 / 1433876_at". https://www.ncbi.nlm.nih.gov/geo/tools/profileGraph.cgi?ID=GDS3917:1433876_at. 
  19. ↑ "Experiment Detail :: Allen Brain Atlas: Mouse Brain". http://mouse.brain-map.org/experiment/show?id=70305096. 
  20. ↑ "Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells". Cell Adhesion & Migration 4 (3): 368–71. 2010-01-01. doi:10.4161/cam.4.3.11606. PMID 20404543. 
  21. ↑ 21.0 21.1 21.2 "A cell surface interaction network of neural leucine-rich repeat receptors". Genome Biology 10 (9): R99. 2009-01-01. doi:10.1186/gb-2009-10-9-r99. PMID 19765300. 
  22. ↑ "Home - dbVar - NCBI". https://www.ncbi.nlm.nih.gov/dbvar.