Biology:Listeria monocytogenes non-coding RNA
| Listeria snRNA rli22 | |
|---|---|
Predicted secondary structure of Listeria snRNA rli22 | |
| Identifiers | |
| Symbol | rli22 |
| Rfam | RF01457 |
| Other data | |
| RNA type | gene, snRNA |
| Domain(s) | Listeria |
| PDB structures | PDBe |
Listeria monocytogenes is a gram positive bacterium and causes many food-borne infections such as Listeriosis. This bacteria is ubiquitous in the environment where it can act as either a saprophyte when free living within the environment or as a pathogen when entering a host organism. Many non-coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non-coding RNAs and may contribute to pathogenesis.[1]
Tiling arrays and mutagenesis identified many non-coding RNAs within the L. monocytogenes genome and the location of these non-coding RNAs within the bacterial genome was confirmed by RACE (rapid amplification of cDNA ends) analysis. These studies showed that the expression of many non-coding RNAs was dependent on the environment and that several of these non-coding RNAs act as cis-regulatory elements. Comparisons between previously characterized non-coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non-coding RNAs in L. monocyotogenes. An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non-coding RNAs that are only present within L. monocytogenes which suggests that these ncRNAs may have a role in pathogenesis.[2] The tables below summarizes the location, flanking genes and also the characteristics of the novel small non-coding RNAs identified and the previously characterized non-coding RNAs present in L. monocytogenes
Novel Non-coding RNAs
| ID | Start | Stop | Size | 5′ flanking gene | sense of the gene on the genome | a | 3′ flanking gene | Characteristic | Rfam | |
|---|---|---|---|---|---|---|---|---|---|---|
| rli22 | 31997 | 32107 | 110 | lmo0028 | -> | -> | -> | lmo0029 | sRNA | |
| rli23 | 172171 | 172268 | 97 | lmo0172 | <- | -> | sRNA Antisense to lmo0172 transposase Homolog of rli25 and rli35. | |||
| rli24 | 271029 | 271186 | 157 | lmo0256 | -> | -> | -> | lmo0257 | sRNA | |
| rli25 | 357618 | 357516 | 102 | lmo0330 | -> | <- | sRNA Antisense to lmo0330: transposase. Homolog of rli23 and rli35 | |||
| rli26 | 388707 | 388520 | 187 | lmo0360 | -> | <- | <- | lmo0361 | sRNA | |
| rli27 | 434831 | 434929 | 98 | lmo0411 | <- | -> | <- | lmo0412 | sRNA | |
| rli28 | 507394 | 507206 | 188 | lmo0470 | -> | <- | -> | lmo0471 | sRNA Homolog of rli50 | |
| rli29 | 507643 | 507450 | 193 | lmo0470 | -> | <- | -> | lmo0471 | sRNA Antisense to the 5'UTR of lmo0471 | |
| rli30 | 540785 | 540670 | 115 | lmo0506 | -> | <- | sRNA Antisense to lmo0506 | |||
| rli31 | 597812 | 597926 | 114 | lmo0558 | <- | -> | -> | lmo0559 | Required for lysozyme resistance and pathogenesis.[3] Structure characterized as two long hairpins. Interacts with the RNA binding global regulator SpoVG.[4] | |
| rli32 | 600750 | 600604 | 147 | lmo0560 | <- | <- | <- | lmo0561 | sRNA | |
| rli33 | 708326 | 708860 | 534 | lmo0671 | -> | -> | -> | lmo0672 | sRNA | |
| rli34 | 803031 | 802948 | 83 | lmo0777 | -> | <- | -> | lmo0778 | sRNA | |
| rli35 | 855495 | 855393 | 102 | lmo0828 | -> | <- | sRNA Antisense to lmo0828: transposase. Homolog of rli23 and rli25 | |||
| rli36 | 859527 | 859444 | 83 | nifJ | -> | <- | <- | fbp | sRNA | |
| rli37 | 907576 | 907832 | 256 | lmo0866 | -> | -> | -> | lmo0867 | ORF ORF of 58aa. RBS region: TGATACGGGAGTGTGGTGCTAGTTATG | |
| rli38 | 1152549 | 1152917 | 369 | lmo1115 | <- | -> | -> | lmo1116 | sRNA role in virulence | |
| rli39 | 1179807 | 1179993 | 187 | lmo1149 | -> | -> | <- | lmo1150 | sRNA Annotated as a cobalamin riboswitch in Rfam | |
| rli40 | 1275810 | 1275547 | 264 | lmo1251 | -> | <- | <- | lmo1252 | ORF ORF of 64 aa. RBS region: AGTGAGGCGTCCTTATG | |
| rli41 | 1277207 | 1276713 | 495 | lmo1252 | <- | <- | -> | lmo1253 | Two ORFs ORF of 45 aa. RBS region: AGAGGAGGTATTTTCTATG ORF of 35 aa. RBS region:AAGGAGGAAAACAAATTG | |
| rli42 | 1399617 | 1399447 | 171 | lmo1374 | -> | <- | -> | lmo1375 | sRNA | |
| rli43 | 1861630 | 1861377 | 253 | inlC | <- | <- | <- | rplS | ORF ORF of 35aa. RBS region: AGAGTGAGGTGTAATATG | |
| rli44 | 2039087 | 2039375 | 289 | lmo1964 | <- | -> | <- | lmo1965 | ORF ORF of 28aa. RBS region: GGAAAGGATAACCCATG | |
| rli45 | 2154775 | 2154852 | 77 | lmo2074 | -> | -> | <- | lmo2075 | sRNA Antisense to rli46 | |
| rli46 | 2155058 | 2154765 | 294 | lmo2074 | -> | <- | <- | lmo2075 | sRNA Antisense to rli45 | |
| rli47 | 2226024 | 2226532 | 508 | lmo2141 | -> | -> | <- | lmo2142 | sRNA | |
| rli48 | 2361423 | 2361274 | 149 | lmo2271 | <- | <- | -> | lmo2272 | sRNA | |
| rli49 | 2660179 | 2660364 | 185 | lmo2579 | -> | -> | <- | lmo2580 | sRNA | |
| rli50 | 2783274 | 2783098 | 176 | lmo2709 | -> | <- | <- | lmo2710 | sRNA Homolog of rli28 | |
| rli51 | 207589 | 207709 | 120 | hly | -> | -> | -> | mpl | 5′-UTR-derived Increased in intestinal lumen | |
| rli52 | 552421 | 552327 | 94 | lmo0517 | <- | <- | <- | lmo0518 | 5′-UTR-derived Putative riboswitch. | |
| rli53 | 955829 | 956001 | 172 | lmo0918 | -> | -> | -> | lmo0919 | 5′-UTR-derived Putative riboswitch. | |
| rli54 | 1078584 | 1079111 | 527 | lmo1051 | <- | -> | -> | pdhA | 5′-UTR-derived Putative riboswitch. | |
| rli55 | 1198107 | 1198389 | 282 | lmo1170 | -> | -> | -> | pduQ | 5′-UTR-derived Putative riboswitch. | |
| rli56 | 1199859 | 1199958 | 99 | pduQ | -> | -> | -> | lmo1172 | 5′-UTR-derived Putative riboswitch. | |
| rli57 | ? | 1216658 | ? | lmo1190 | -> | -> | -> | cbiA | 3′-UTR-derived Annotated as a cobalamin riboswitch in Rfam lmo1190-rli57 transcript levelncreasedinintestinal lumen | |
| rli58 | ? | 1639974 | ? | rpsD | -> | <- | <- | lmo1597 | ||
| rli59 | 1702553 | 1702373 | 180 | lmo1652 | <- | <- | <- | lmo1653 | 5′-UTR-derived | |
| rli60 | 2054124 | 2054308 | 184 | lmo1982 | <- | -> | -> | ilvD | 5′-UTR-derived Putative riboswitch. | |
| rli61 | 2275363 | 2275258 | 106 | lmo2187 | <- | <- | <- | lmo2188 | 5′-UTR-derived Putative riboswitch | |
| rli62 | 2364508 | 2364337 | 172 | lmo2277 | <- | <- | <- | lmo2278 | 5′-UTR-derived Putative riboswitch. | |
| rli63 | 2613301 | ? | ? | atpI | <- | <- | <- | lmo2537 | 5′-UTR-derived Putative riboswitch | |
| rliA | 513584 | 513807 | 224 | lmo0476 | <- | >- | >- | lmo0477 | snRNA | |
| rliB | 544357 | 544716 | 360 | lmo0509 | -> | -> | -> | lmo0510 | sRNA | |
| rliC | 1154309 | 1154671 | 363 | lmo1117 | -> | -> | <- | lmo1118 | sRNA | |
| rliD | 1359529 | 1359202 | 328 | rpsO | -> | <- | -> | pnpA | sRNA antisense | |
| rliE | 1584586 | 1584808 | 223 | comC | <- | -> | <- | folC | sRNA antisense to comC mRNA | |
| rliF | 2106292 | 2106073 | 220 | nadA | -> | <- | <- | lmo2026 | snRNA | |
| rliG | 2386992 | 2386715 | 278 | lmo2302 | <- | <- | <- | lmo2303 | sRNA | |
| rliH | 1180826 | 1181254 | 429 | lmo1150 | <- | -> | -> | lmo1151 | sRNA antisense | |
| rliI | 2842200 | 2841962 | 239 | lmo2760 | <- | <- | -> | lmo2761 | sRNA | |
| sbrA[5] | 1399363 | 1399433 | 70 | lmo1374 | -> | -> | -> | lmo1375 | sRNA |
aArrows indicate the sense of the gene on the genome. Bold arrows indicate gene absent from L. innocua.
Listeria monocytogenes EGD-e strain was used in these studies EMBL accession AL591824.1
Characterised non-coding RNAs
|
|
|
References
- ↑ "Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets". Nucleic Acids Res. 35 (3): 962–974. 2007. doi:10.1093/nar/gkl1096. PMID 17259222.
- ↑ "The Listeria transcriptional landscape from saprophytism to virulence". Nature 459 (7249): 950–956. June 2009. doi:10.1038/nature08080. PMID 19448609. Bibcode: 2009Natur.459..950T.
- ↑ "Listeria monocytogenes is resistant to lysozyme through the regulation, not the acquisition, of cell wall-modifying enzymes". J. Bacteriol. 196 (21): 3756–3767. 2014. doi:10.1128/JB.02053-14. PMID 25157076.
- ↑ "SpoVG Is a Conserved RNA-Binding Protein That Regulates Listeria monocytogenes Lysozyme Resistance, Virulence, and Swarming Motility". mBio 7 (2). 2016. doi:10.1128/mBio.00240-16. PMID 27048798.
- ↑ "Identification of a sigma B-dependent small noncoding RNA in Listeria monocytogenes.". J Bacteriol 190 (18): 6264–6270. 2008. doi:10.1128/JB.00740-08. PMID 18621897.
External links
