Biology:Listeria monocytogenes non-coding RNA

From HandWiki
Listeria snRNA rli22
Predicted secondary structure of Listeria snRNA rli22
Identifiers
Symbolrli22
RfamRF01457
Other data
RNA typegene, snRNA
Domain(s)Listeria
PDB structuresPDBe

Listeria monocytogenes is a gram positive bacterium and causes many food-borne infections such as Listeriosis. This bacteria is ubiquitous in the environment where it can act as either a saprophyte when free living within the environment or as a pathogen when entering a host organism. Many non-coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non-coding RNAs and may contribute to pathogenesis.[1]

Tiling arrays and mutagenesis identified many non-coding RNAs within the L. monocytogenes genome and the location of these non-coding RNAs within the bacterial genome was confirmed by RACE (rapid amplification of cDNA ends) analysis. These studies showed that the expression of many non-coding RNAs was dependent on the environment and that several of these non-coding RNAs act as cis-regulatory elements. Comparisons between previously characterized non-coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non-coding RNAs in L. monocyotogenes. An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non-coding RNAs that are only present within L. monocytogenes which suggests that these ncRNAs may have a role in pathogenesis.[2] The tables below summarizes the location, flanking genes and also the characteristics of the novel small non-coding RNAs identified and the previously characterized non-coding RNAs present in L. monocytogenes

Novel Non-coding RNAs

ID Start Stop Size 5′ flanking gene sense of the gene on the genome a 3′ flanking gene Characteristic Rfam
rli22 31997 32107 110 lmo0028 -> -> -> lmo0029 sRNA
rli23 172171 172268 97 lmo0172 <- -> sRNA Antisense to lmo0172 transposase Homolog of rli25 and rli35.
rli24 271029 271186 157 lmo0256 -> -> -> lmo0257 sRNA
rli25 357618 357516 102 lmo0330 -> <- sRNA Antisense to lmo0330: transposase. Homolog of rli23 and rli35
rli26 388707 388520 187 lmo0360 -> <- <- lmo0361 sRNA
rli27 434831 434929 98 lmo0411 <- -> <- lmo0412 sRNA
rli28 507394 507206 188 lmo0470 -> <- -> lmo0471 sRNA Homolog of rli50
rli29 507643 507450 193 lmo0470 -> <- -> lmo0471 sRNA Antisense to the 5'UTR of lmo0471
rli30 540785 540670 115 lmo0506 -> <- sRNA Antisense to lmo0506
rli31 597812 597926 114 lmo0558 <- -> -> lmo0559 Required for lysozyme resistance and pathogenesis.[3] Structure characterized as two long hairpins. Interacts with the RNA binding global regulator SpoVG.[4]
rli32 600750 600604 147 lmo0560 <- <- <- lmo0561 sRNA
rli33 708326 708860 534 lmo0671 -> -> -> lmo0672 sRNA
rli34 803031 802948 83 lmo0777 -> <- -> lmo0778 sRNA
rli35 855495 855393 102 lmo0828 -> <- sRNA Antisense to lmo0828: transposase. Homolog of rli23 and rli25
rli36 859527 859444 83 nifJ -> <- <- fbp sRNA
rli37 907576 907832 256 lmo0866 -> -> -> lmo0867 ORF ORF of 58aa. RBS region: TGATACGGGAGTGTGGTGCTAGTTATG
rli38 1152549 1152917 369 lmo1115 <- -> -> lmo1116 sRNA role in virulence
rli39 1179807 1179993 187 lmo1149 -> -> <- lmo1150 sRNA Annotated as a cobalamin riboswitch in Rfam
rli40 1275810 1275547 264 lmo1251 -> <- <- lmo1252 ORF ORF of 64 aa. RBS region: AGTGAGGCGTCCTTATG
rli41 1277207 1276713 495 lmo1252 <- <- -> lmo1253 Two ORFs ORF of 45 aa. RBS region: AGAGGAGGTATTTTCTATG ORF of 35 aa. RBS region:AAGGAGGAAAACAAATTG
rli42 1399617 1399447 171 lmo1374 -> <- -> lmo1375 sRNA
rli43 1861630 1861377 253 inlC <- <- <- rplS ORF ORF of 35aa. RBS region: AGAGTGAGGTGTAATATG
rli44 2039087 2039375 289 lmo1964 <- -> <- lmo1965 ORF ORF of 28aa. RBS region: GGAAAGGATAACCCATG
rli45 2154775 2154852 77 lmo2074 -> -> <- lmo2075 sRNA Antisense to rli46
rli46 2155058 2154765 294 lmo2074 -> <- <- lmo2075 sRNA Antisense to rli45
rli47 2226024 2226532 508 lmo2141 -> -> <- lmo2142 sRNA
rli48 2361423 2361274 149 lmo2271 <- <- -> lmo2272 sRNA
rli49 2660179 2660364 185 lmo2579 -> -> <- lmo2580 sRNA
rli50 2783274 2783098 176 lmo2709 -> <- <- lmo2710 sRNA Homolog of rli28
rli51 207589 207709 120 hly -> -> -> mpl 5′-UTR-derived Increased in intestinal lumen
rli52 552421 552327 94 lmo0517 <- <- <- lmo0518 5′-UTR-derived Putative riboswitch.
rli53 955829 956001 172 lmo0918 -> -> -> lmo0919 5′-UTR-derived Putative riboswitch.
rli54 1078584 1079111 527 lmo1051 <- -> -> pdhA 5′-UTR-derived Putative riboswitch.
rli55 1198107 1198389 282 lmo1170 -> -> -> pduQ 5′-UTR-derived Putative riboswitch.
rli56 1199859 1199958 99 pduQ -> -> -> lmo1172 5′-UTR-derived Putative riboswitch.
rli57 ? 1216658 ? lmo1190 -> -> -> cbiA 3′-UTR-derived Annotated as a cobalamin riboswitch in Rfam lmo1190-rli57 transcript levelncreasedinintestinal lumen
rli58 ? 1639974 ? rpsD -> <- <- lmo1597
rli59 1702553 1702373 180 lmo1652 <- <- <- lmo1653 5′-UTR-derived
rli60 2054124 2054308 184 lmo1982 <- -> -> ilvD 5′-UTR-derived Putative riboswitch.
rli61 2275363 2275258 106 lmo2187 <- <- <- lmo2188 5′-UTR-derived Putative riboswitch
rli62 2364508 2364337 172 lmo2277 <- <- <- lmo2278 5′-UTR-derived Putative riboswitch.
rli63 2613301 ? ? atpI <- <- <- lmo2537 5′-UTR-derived Putative riboswitch
rliA 513584 513807 224 lmo0476 <- >- >- lmo0477 snRNA
rliB 544357 544716 360 lmo0509 -> -> -> lmo0510 sRNA
rliC 1154309 1154671 363 lmo1117 -> -> <- lmo1118 sRNA
rliD 1359529 1359202 328 rpsO -> <- -> pnpA sRNA antisense
rliE 1584586 1584808 223 comC <- -> <- folC sRNA antisense to comC mRNA
rliF 2106292 2106073 220 nadA -> <- <- lmo2026 snRNA
rliG 2386992 2386715 278 lmo2302 <- <- <- lmo2303 sRNA
rliH 1180826 1181254 429 lmo1150 <- -> -> lmo1151 sRNA antisense
rliI 2842200 2841962 239 lmo2760 <- <- -> lmo2761 sRNA
sbrA[5] 1399363 1399433 70 lmo1374 -> -> -> lmo1375 sRNA

aArrows indicate the sense of the gene on the genome. Bold arrows indicate gene absent from L. innocua.

Listeria monocytogenes EGD-e strain was used in these studies EMBL accession AL591824.1

Characterised non-coding RNAs

ID Rfam
SAM RF00162
LhrC RF00616
TPP RF00059
glmS RF00234
PreQ1 RF00522
T-box RF00230
SsrS RF00013
ID Rfam
LhrB RF00558
FMN RF00050
ssrA RF00023
SRP RF00169
PrfA RF00038
L10 leader RF00557
Purine RF00167
ID Rfam
lysine RF00168
yybP-ykoY RF00080
glycine RF00504
L21 RF00559
RyrR RF00515
LhrA RF00615
L13 RF00555

References

Template:Listeria