Biology:Human identical sequence
From HandWiki
The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome.[1] In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes.[2][3] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five.[1] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats).[1]
SARS-CoV-2
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-SARS2-1 | 26 | UGUCUAUGCUAAUGGAGGUAAAGGCU | 7570–7595 in ORF1a | Chr3: 124017420-124017395 | KALRN | |
| HIS-SARS2-2 | 24 | UAUAACACAUATAAAAAUACGUGU | 12494–12517 in ORF1a | Chr3: 176597319-176597342 | ||
| HIS-SARS2-3 | 24 | UUAUAUGCCUUAUUUCUUUACUUU | 6766–6789 in ORF1a | Chr5: 28949255-28949232 | ||
| HIS-SARS2-4 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29860–29886 in 3' UTR | Chr18: 73670168-73670142 | FBXO15, TIMM21, CYB5A | same as HIS-SARS1-2 |
| HIS-SARS2-5 | 24 | UUGUUGCUGCUAUUUUCUAUUUAA | 8610–8633 in ORF1a | ChrX: 99693480-99693457 |
SARS-CoV-1
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-SARS-1 | 25 | UAACAUGCUUAGGAUAAUGGCCUCU | 15251–15275 in ORF1b | Chr4: 172887105-172887129 Chr8: 122356667-122356690 |
HAS2, ZHX2 | |
| HIS-SARS-2 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29717–29743 in 3' UTR | Chr18: 73670168-73670142 | same as HIS-SARS2-4 |
MERS-CoV
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-MERS-1 | 24 | UUCCAUUUGCACAGAGUAUCUUUU | 24364–24387 in S | ChrX: 25635779-25635802 |
HCoV-HKU1
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-HKU1-1 | 24 | UUAGAAUUGUUCAAAUGUUAUCUG | 18656-18679 | chr1:106816197-106816220 | ||
| HIS-HKU1-2 | 24 | UUUUCUAAGAAAGAUUGGUAUGAU | 14044-14067 | chr1:226438633-226438656 chr4:151100495-151100518 chr5:79284823-79284846 chr5:111192947-111192970 chr7:94695722-94695745 chr7:98386489-98386512 chr15:59768424-59768447 chr22:30137367-30137390 |
||
| HIS-HKU1-3 | 24 | AUUUGACUUUAAAUCUUCAUACUA | 26693-26716 | chr4:11718458-11718481 | ||
| HIS-HKU1-4 | 24 | GAUUGGUUGUAUUUUCAUUUUUAU | 23527-23550 | chr4:33759646-33759669 | ||
| HIS-HKU1-5 | 24 | UAGAUACUGUUAUUUUUAAAAAUA | 19844-19867 | chrX:81711130-81711153 |
HCoV-NL63
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-NL63-1 | 24 | UUAUGAUUUUGGUGAUUUUGUUGU | 13044-13067 | chr1:215311768-215311791 | ||
| HIS-NL63-2 | 24 | GGUGUUUUUGUUGAUGAUGUUGUU | 14920-14943 | chr4:28254452-28254475 | ||
| HIS-NL63-3 | 24 | AUAGGCUUAAAUGCUUCUGUUACU | 20754-20777 | chr6:30469931-30469954 | ||
| HIS-NL63-4 | 24 | AAGUAAUUGUAUUAAGAUGUUAUC | 12124-12147 | chr7:19853545-19853568 | ||
| HIS-NL63-5 | 24 | AACUUUUAUGAUUUUGGUGAUUUU | 13039-13062 | chr9:1525276-1525299 |
HCoV-OC43
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-OC43-1 | 24 | UACAGCUCUUUGUAAAUCUGGUAG | 22827-22850 | chr8:122471006-122471029 | HAS2, ZHX2 | |
| HIS-OC43-2 | 24 | UUGUAUGAGUGAUUUUAUGAGUGA | 24509-24532 | chr13:30510223-30510246 |
HCoV-229E
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-229E-1 | 24 | AAUAUUUUAACAGUACCACGUUAU | 19817-19840 | chr8:42865576-42865599 | ||
| HIS-229E-2 | 24 | ACUUUGUAUUGUGUCCUCCUGGAA | 13139-13162 | chr11:112451251-112451274 |
References
- ↑ 1.0 1.1 1.2 Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A et al. (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network.". EBioMedicine 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMID 35124429.
- ↑ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M et al. (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression.". Signal Transduction and Targeted Therapy 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMID 35304437.
- ↑ "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology 14 (10): 1326–1334. October 2017. doi:10.1080/15476286.2015.1112487. PMID 26853707.
