Biology:Human identical sequence

From HandWiki

The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome.[1] In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes.[2][3] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five.[1] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats).[1]

SARS-CoV-2

name length sequence location in virus genome location in human genome neighboring genes note
HIS-SARS2-1 26 UGUCUAUGCUAAUGGAGGUAAAGGCU 7570–7595 in ORF1a Chr3: 124017420-124017395 KALRN
HIS-SARS2-2 24 UAUAACACAUATAAAAAUACGUGU 12494–12517 in ORF1a Chr3: 176597319-176597342
HIS-SARS2-3 24 UUAUAUGCCUUAUUUCUUUACUUU 6766–6789 in ORF1a Chr5: 28949255-28949232
HIS-SARS2-4 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29860–29886 in 3' UTR Chr18: 73670168-73670142 FBXO15, TIMM21 (uk), CYB5A same as HIS-SARS1-2
HIS-SARS2-5 24 UUGUUGCUGCUAUUUUCUAUUUAA 8610–8633 in ORF1a ChrX: 99693480-99693457

SARS-CoV-1

name length sequence location in virus genome location in human genome neighboring genes note
HIS-SARS-1 25 UAACAUGCUUAGGAUAAUGGCCUCU 15251–15275 in ORF1b Chr4: 172887105–172887129
Chr8: 122356667-122356690
HAS2, ZHX2
HIS-SARS-2 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29717–29743 in 3' UTR Chr18: 73670168-73670142 same as HIS-SARS2-4

MERS-CoV

name length sequence location in virus genome location in human genome neighboring genes note
HIS-MERS-1 24 UUCCAUUUGCACAGAGUAUCUUUU 24364–24387 in S ChrX: 25635779-25635802

HCoV-HKU1

name length sequence location in virus genome location in human genome neighboring genes note
HIS-HKU1-1 24 UUAGAAUUGUUCAAAUGUUAUCUG 18656-18679 chr1:106816197-106816220
HIS-HKU1-2 24 UUUUCUAAGAAAGAUUGGUAUGAU 14044-14067 chr1:226438633-226438656
chr4:151100495-151100518
chr5:79284823-79284846
chr5:111192947-111192970
chr7:94695722-94695745
chr7:98386489-98386512
chr15:59768424-59768447
chr22:30137367-30137390
HIS-HKU1-3 24 AUUUGACUUUAAAUCUUCAUACUA 26693-26716 chr4:11718458-11718481
HIS-HKU1-4 24 GAUUGGUUGUAUUUUCAUUUUUAU 23527-23550 chr4:33759646-33759669
HIS-HKU1-5 24 UAGAUACUGUUAUUUUUAAAAAUA 19844-19867 chrX:81711130-81711153

HCoV-NL63

name length sequence location in virus genome location in human genome neighboring genes note
HIS-NL63-1 24 UUAUGAUUUUGGUGAUUUUGUUGU 13044-13067 chr1:215311768-215311791
HIS-NL63-2 24 GGUGUUUUUGUUGAUGAUGUUGUU 14920-14943 chr4:28254452-28254475
HIS-NL63-3 24 AUAGGCUUAAAUGCUUCUGUUACU 20754-20777 chr6:30469931-30469954
HIS-NL63-4 24 AAGUAAUUGUAUUAAGAUGUUAUC 12124-12147 chr7:19853545-19853568
HIS-NL63-5 24 AACUUUUAUGAUUUUGGUGAUUUU 13039-13062 chr9:1525276-1525299

HCoV-OC43

name length sequence location in virus genome location in human genome neighboring genes note
HIS-OC43-1 24 UACAGCUCUUUGUAAAUCUGGUAG 22827-22850 chr8:122471006-122471029 HAS2, ZHX2
HIS-OC43-2 24 UUGUAUGAGUGAUUUUAUGAGUGA 24509-24532 chr13:30510223-30510246

HCoV-229E

name length sequence location in virus genome location in human genome neighboring genes note
HIS-229E-1 24 AAUAUUUUAACAGUACCACGUUAU 19817-19840 chr8:42865576-42865599
HIS-229E-2 24 ACUUUGUAUUGUGUCCUCCUGGAA 13139-13162 chr11:112451251-112451274

References

  1. 1.0 1.1 1.2 Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A et al. (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network.". EBioMedicine 76. doi:10.1016/j.ebiom.2022.103861. PMID 35124429. 
  2. Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M et al. (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression.". Signal Transduction and Targeted Therapy 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMID 35304437. 
  3. "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology 14 (10): 1326–1334. October 2017. doi:10.1080/15476286.2015.1112487. PMID 26853707. 

Template:Coronavirus genomes