Biology:ZNF821

From HandWiki

Zinc Finger Protein 821, also known as ZNF821, is a protein encoded by the ZNF821 gene. This gene is located on the 16th chromosome and is expressed highly in the testes, moderately expressed in the brain and low expression in 23 other tissues. The protein encoded is 412 amino acids long with 2 Zinc Finger motifs (C2H2 type) and a 23 amino acid long STPR domain.

Gene

Locus

ZNF821 is located at 16q22.2 on the minus strand, it is composed of 35,657 bases spanning from base 71,893,583 to 71,929,239. ZNF821 has 8 exons and is located in the same neighborhood as 4 other genes, ATXNL1, IST1, PKD1L3, AP1G1.[1]

Transcriptional Regulation

Transcription of ZNF821 is handled by the promoter GXP_9784938 which is 539 bases long and located from base 71,884,046 to 71,884,585. The promoter region begins 404 base pairs upstream of the beginning of transcription. Several transcription factors with scores greater than 0.9 are predicted to regulate ZNF821 expression.

Transcription factor Abbreviation Binding Site Strand
Myeloid zinc finger protein MZF1 GTGGGGATCCG +
Cyclin D binding myb-like transcription factor DMTF CACCCCTAGGCCCGA -
Early growth response 2 EGRF GAGAGGGGGTGCCTGCGGC +
Human acute myelogenous leukemia factors HAML AGCTGTGGTTGGGGG +
C2H2 zinc finger transcription factors 2 ZF02 GACTTGAGCTACCACCCCATTCT -
Hypoxia-response elements HIFF CCATCCCACCGCAAATGTGCAGGTC -
Ets variant 1 ETSF CACGTCCAGGAAGGTCTGGGG +
Homeobox transcription factor Nanog HOXF ACCCGGGAATGGGCGAGGC +
GLIS family zinc finger 3 GLIF CGCTCCGCCCCCCAAGG -
GTF2I-like repeat 4 of GTF3 GUCE CGGGATTGGGC +
zinc finger protein with KRAB and SCAN domains 12 ZF07 GGAGCCCCTCCTCTCCA +
Myc associated zinc finger protein MAZF GTCTCGGGGAGAGGAGTCCGGGGCGGGTGTT -
Zinc finger and BTB domain containing 14 VF5F CGGTCCGCGCGCGGCCC + , -
Transcription factor II B (TFIIB) recognition element TF2B CCGCGCC -
Zinc finger protein 37 alpha ZF37 CCTCCCCCT -
E2F transcription factor 1 E2FF CGCGCGAGGGCGGCGGG -
Cas-interacting zinc finger CIZF GTAGAAAAAGG -
Sma- and Mad-related proteins SMAD TCTGTCTGTCT +
SRY (sex determining region Y)-box 6 SORY CAGACAGACAGACGACAACCGAAACAGGCAG -

Expression

ZNF821 is highly expressed in the testes, almost 2.5 times as much as in the brain, the next most highly expressed in tissue. Expression in the brain is primarily during fetal development, with lower levels of expression occurring in the cerebellum. There are low levels of expression in most other tissues.

mRNA

Variants and Isoforms

ZNF821 has 7 different transcript variants and 4 isoforms.[2] Variant 1 Isoform 1 is the second longest and but most abundant of all the variants and isoforms. While variant 2 is longer, it contains one fewer exon. Variant 1, Isoform 1 is 1987 bases long with a 5' UTR 415 bases long and a 3' UTR 433 bases long.

Variant Isoform Length # of Exons
1 1 1987 8
2 1 2005 7
3 2 1894 7
4 2 1879 6
5 3 1853 7
6 4 1959 8
7 4 1722 7

Protein

Characteristics

The protein encoded by the ZNF821 gene is 412 amino acids long with a calculated molecular weight of ~ 47 kDa and a predicted isoelectric point of 6.14. Compared to the rest of the human proteome, there are decreased amounts of Isoleucine and Tyrosine residues as well as increased levels of Arginine residues.[3]

Structure

AlphaFold prediction of ZNF821 Protein.

ZNF821 protein contains two C2H2 Zinc Finger motifs (spanning amino acids 120-140 and 152–172, respectively) and an STPR (one-score-and-three-amino acid peptide repeat) domain (spanning amino acids 223–314) containing a bipartite nuclear localization signal. This STPR domain is a double-stranded DNA-binding domain with similar traits to the silkworm FMBP-1 STPR domain and is thought to be responsible for the nuclear localization of the ZNF821 protein.[4] The secondary structure of the ZNF821 protein is composed of several alpha helical structures along with two small regions of beta sheets.[5][6][7][8] The tertiary structure of the ZNF821 protein provides exposure of the Zinc Fingers for presumed DNA-binding.[9]

Cellular Localization

The ZNF821 protein binds to DNA making it highly likely to be localized to the nucleus, there is also a bipartite nuclear localization sequence from Lys280 to Arg297, Lys304 to Leu320, and Lys338 to Arg354. An analysis of the subcellular localization in both close and distant orthologs resulted in a >99% chance of being localized to the nucleus for all orthologs.[10]

Regulation

The ZNF821 protein is predicted to be modified post-translationally at several different positions. When compared with both close and distant orthologous sequences two phosphorylation sites are conserved, the Serine at position 2 and the Threonine at position 7.[11] It is also predicted by several sources to have further phosphorylation sites of the Serine at position 254 and the Tyrosine at position 279.[12][11]

Interactions

Several proteins have been shown to interact with the ZNF821 protein, many of them relating to transcriptional regulation.[13]

Abbreviation Protein Name Identification Method Function
ATM ATM Serine/Threonine kinase Two Hybrid Array Activates checkpoint signaling upon sensing DNA damage
CCDC85B Coiled-coil domain-containing protein 85B Two Hybrid Pooling Transcriptional Repressor
SMARCA2 Probable global transcription activator SNF2L2 Two Hybrid Pooling Transcriptional activation and repression by chromatin remodeling
CDCA7L Cell division cycle-associated 7-like protein Two Hybrid Array Transcriptional Repressor
PIM2 Serine/threonine-protein kinase Pim-2 Two Hybrid Array Proto-oncogene
DVL3 Segment polarity protein dishevelled homolog DVL-3 Two Hybrid Array Cell signal transduction
RUNDC3A RUN domain-containing protein 3A Two Hybrid Array Effector of RAPA2A
FXR1 Fragile X mental retardation syndrome-related protein 1 Two Hybrid Pooling RNA-binding protein

Homology

Paralogs

ZNF821 has no paralogs in humans.[1]

Orthologs

There are orthologs for ZNF821 across vertebrates, but none for the protein in invertebrates. The Zinc Finger motifs are conserved into invertebrates. The STPR domain is only present in mammals.

Genus Species Common name Taxonomy Date of Divergence (MYA) Sequence length (AA) Sequence identity (%)
Homo sapiens Human Primates 0.00 412 100.00
Pongo abelii Sumatran Orangutan Primates 15.20 412 99.76
Lacerta agilis Sand lizard Squamata 318.00 429 76.33
Chrysemys picta bellii Western Painted turtle Testudines 318.00 411 87.65
Gopherus evgoodei Sinaloan desert tortoise Testudines 318.00 413 86.44
Antrostomus carolinensis Chuck-will's-widow Caprimulgiformes 318.00 411 86.20
Apteryx rowi Okarito kiwi Apterygiformes 318.00 482 87.41
Leptosomus discolor Cuckoo roller Leptosomiformes 318.00 410 85.68
Xenopus laevis Two-lined caecilian Gymnophiona 351.70 409 76.76
Geotrypetes seraphini Gaboon caecilian Gymnophiona 351.70 378 75.26
Bufo bufo Common toad Anura 351.70 395 66.75
Rhinatrema bivittatum African clawed frog Anura 351.70 398 69.64
Pygocentrus nattereri Red-bellied piranha Characiformes 433.00 456 48.58
Cyprinus carpio Common Carp Cypriniformes 433.00 441 49.56
Polypterus senegalus Senegal bichir Polypteriformes 433.00 539 54.59
Erpetoichthys calabaricus Reedfish Polypteriformes 433.00 471 49.58
Paramormyrops kingsleyae Old Calabar mormyrid Osteoglossiformes 433.00 443 53.63
Carcharodon carcharias Great white shark Lamniformes 465.00 360 42.07
Divergence Rate of ZNF821 compared to Cytochrome c and Fibrinogen alpha.

The relative rate of divergence is slow when compared to the rates of two reference proteins, Cytochrome c and Fibrinogen alpha, but increases to slightly faster than Cytochrome c as the date of divergence gets closer to the present.

Clinical Significance

ZNF821 has been associated in some capacity with several different diseases and conditions. It has been implicated in causing craniosynostosis through interactions with the transcription factor BCL11B by affecting the charges on the arginine-3, arginine-5, and lysine-3 residues, thereby increasing their conformational flexibility.[14] It has also been found to be a possible biomarker for methamphetamine-associated psychosis (MAP) via the process of RNA-degradation.[15] Another disease association is that with breast cancer as part of a DNA-repair sub network. ZNF821 was found to be dysregulated among breast cancer patients.[16] Finally, there is a study showing an increase in methylation over time on ZNF821 in Parkinson's disease patients who did not receive L-dopa/entacapone. This provides a clearer view of changes due only to Parkinson's pathophysiology.[17]

References

  1. 1.0 1.1 "Human BLAT Search". https://genome.ucsc.edu/cgi-bin/hgBlat. 
  2. "ZNF821 zinc finger protein 821 [Homo sapiens (human) - Gene - NCBI"]. https://www.ncbi.nlm.nih.gov/gene/55565. 
  3. "SAPS < Sequence Statistics < EMBL-EBI". https://www.ebi.ac.uk/Tools/seqstats/saps/. 
  4. "STPR, a 23-amino acid tandem repeat domain, found in the human function-unknown protein ZNF821". Biochemistry 49 (38): 8367–8375. September 2010. doi:10.1021/bi100448f. PMID 20795678. 
  5. "NPS@ : SOPMA secondary structure prediction". https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_sopma.html. 
  6. Figure S6: Predicted secondary structure of CoV-RMEN using CFSSP:Chou and Fasman secondary structure prediction server. doi:10.7717/peerj.9572/supp-13. 
  7. "Bioinformatics Toolkit". https://toolkit.tuebingen.mpg.de/tools/ali2d. 
  8. "Prediction of the Secondary Structure by GOR". http://cib.cf.ocha.ac.jp/bitool/GOR/. 
  9. "AlphaFold Protein Structure Database". https://alphafold.ebi.ac.uk/. 
  10. "Services" (in en). https://services.healthtech.dtu.dk/. 
  11. 11.0 11.1 "Motif Scan" (in en). https://myhits.sib.swiss/cgi-bin/motif_scan. 
  12. "PhosphoSitePlus". https://www.phosphosite.org/homeAction. 
  13. "PSICQUIC View". http://www.ebi.ac.uk/Tools/webservices/psicquic/view/home.xhtml;jsessionid=73BD9A8D5B30A4700F34B1BF0138F9CB?conversationContext=1. 
  14. "A de novo substitution in BCL11B leads to loss of interaction with transcriptional complexes and craniosynostosis". Human Molecular Genetics 28 (15): 2501–2513. August 2019. doi:10.1093/hmg/ddz072. PMID 31067316. 
  15. "Candidate gene networks and blood biomarkers of methamphetamine-associated psychosis: an integrative RNA-sequencing report". Translational Psychiatry 6 (5): e802. May 2016. doi:10.1038/tp.2016.67. PMID 27163203. 
  16. "Systematic identification of molecular links between core and candidate genes in breast cancer". Journal of Molecular Biology 427 (6 Pt B): 1436–1450. March 2015. doi:10.1016/j.jmb.2015.01.014. PMID 25640309. 
  17. "DNA methylation changes associated with Parkinson's disease progression: outcomes from the first longitudinal genome-wide methylation analysis in blood". Epigenetics 14 (4): 365–382. April 2019. doi:10.1080/15592294.2019.1588682. PMID 30871403.