Biology:Echinoderm and flatworm mitochondrial code
The echinoderm and flatworm mitochondrial code (translation table 9) is a genetic code used by the mitochondria of certain echinoderm and flatworm species.[1]
The code
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGGStarts = -----------------------------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (9) | Standard code (1) | |
|---|---|---|---|---|
| AAA | AAA | Asn (N) | Lys (K) | |
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| TGA | UGA | Trp (W) | STOP = Ter (*) |
Systematic range
- Asterozoa (starfishes) [2]
- Echinozoa (sea urchins) [3][4]
- Rhabditophora among the Platyhelminthes[5]
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [1]
- ↑ 1.0 1.1 Elzanowski, Andrzej; Ostell, Jim; Leipe, Detlef; Soussov, Vladimir. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. https://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=tgencodes#thetop.
- ↑ H. Himeno; H. Masaki; T. Kawai; T. Ohta; I. Kumagai; K. Miura; K. Watanabe (1987). "Unusual genetic codes and a novel gene structure for tRNA(AGYSer) in starfish mitochondrial DNA". Gene 56 (2–3): 219–30. doi:10.1016/0378-1119(87)90139-9. PMID 3678836.
- ↑ H. T. Jacobs; D. J. Elliott; V. B. Math; A. Farquharson (20 July 1988). "Nucleotide sequence and gene organization of sea urchin mitochondrial DNA.". J Mol Biol 202 (2): 185–217. doi:10.1016/0022-2836(88)90452-4. PMID 3172215.
- ↑ P. Cantatore; M. Roberti; G. Rainaldi; M. N. Gadaleta; C. Saccone (5 July 1989). "The complete nucleotide sequence, gene organization, and genetic code of the mitochondrial genome of Paracentrotus lividus". J Biol Chem 264 (19): 10965–75. doi:10.1016/S0021-9258(18)60413-2. PMID 2544576.
- ↑ M. J. Telford; E. A. Herniou; R. B. Russell; D. T. Littlewood (10 October 2000). "Changes in mitochondrial genetic codes as phylogenetic characters: two examples from the flatworms". Proc Natl Acad Sci U S A 97 (21): 11359–64. doi:10.1073/pnas.97.21.11359. PMID 11027335. Bibcode: 2000PNAS...9711359T.
 |  |
