Biology:Ciliate, dasycladacean and hexamita nuclear code
The ciliate, dasycladacean and Hexamita nuclear code (translation table 6) is a genetic code used by certain ciliate, dasycladacean and Hexamita species.
The ciliate macronuclear code has not been determined completely. The codon UAA is known to code for Gln only in the Oxytrichidae.
The code
AAs = FFLLSSSSYYQQCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (6) | Standard code (1) | |
|---|---|---|---|---|
| TAA | UAA | Gln (Q) | STOP = Ter (*) | |
| TAG | UAG | Gln (Q) | STOP = Ter (*) |
Systematic range
- Ciliata: Oxytricha and Stylonychia,[1] Paramecium, Tetrahymena, Oxytrichidae and probably Glaucoma chattoni.
- Dasycladaceae: Acetabularia,[2] and Batophora.[3]
- Diplomonadida: Hexamita inflata, Diplomonadida ATCC50330, and ATCC50380.
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [4]
- ↑ "Macronuclear gene-sized molecules of hypotrichs". Nucleic Acids Research 23 (8): 1279–83. 1995. doi:10.1093/nar/23.8.1279. PMID 7753617.
- ↑ "Strong homology between the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase of two species of Acetabularia and the occurrence of unusual codon usage". Molecular & General Genetics 218 (3): 445–52. 1989. doi:10.1007/bf00332408. PMID 2573818.
- ↑ "Sequences of two rbcS cDNA clones of Batophora oerstedii: structural and evolutionary considerations". Current Genetics 20 (1–2): 173–5. 1991. doi:10.1007/bf00312782. PMID 1934113.
- ↑ Elzanowski, Andrzej; Ostell, Jim; Leipe, Detlef; Soussov, Vladimir. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. https://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=tgencodes#thetop.
External links
- "A non-canonical genetic code in an early diverging eukaryotic lineage". The EMBO Journal 15 (9): 2285–90. 1996. doi:10.1002/j.1460-2075.1996.tb00581.x. PMID 8641293.
 |  |
