Biology:Thraustochytrium mitochondrial code
The Thraustochytrium mitochondrial code (translation table 23) is a genetic code found in the mitochondria of the labyrinthulid protist Thraustochytrium aureum.[1] The mitochondrial genome was sequenced by the Organelle Genome Megasequencing Program.
Code
AAs = FF*LSSSSYY**CC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------------------------M--M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine|Glutamine (Gln, Q), Glycine (Gly, G), [[Chemistry:Histidine|Histidine]] (His, H), [[Chemistry:Isoleucine (Ile, I), [[Chemistry:Leucine|Leucine]] (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine|Tyrosine|Tyrosine|Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
It is the similar to the bacterial code (translation table 11) but it contains an additional stop codon (TTA) and also has a different set of start codons.
| DNA codons | RNA codons | This code (23) | Standard code (1) | |
|---|---|---|---|---|
TTA |
UUA |
STOP = Ter (*) |
Leu (L)
|
Systematic range and comments
- Mitochondria of Thraustochytrium aureum.
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
- ↑ Wideman, Jeremy G.; Monier, Adam; Rodríguez-Martínez, Raquel; Leonard, Guy; Cook, Emily; Poirier, Camille; Maguire, Finlay; Milner, David S. et al. (2019-11-25). "Unexpected mitochondrial genome diversity revealed by targeted single-cell genomics of heterotrophic flagellated protists" (in en). Nature Microbiology 5 (1): 154–165. doi:10.1038/s41564-019-0605-4. ISSN 2058-5276. PMID 31768028. https://www.nature.com/articles/s41564-019-0605-4.
- ↑ Elzanowski, Andrzej; Ostell, Jim; Leipe, Detlef; Soussov, Vladimir. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. https://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=tgencodes#thetop.
External links
 |  |
