Biology:Chlorophycean mitochondrial code
The chlorophycean mitochondrial code (translation table 16) is a genetic code found in the mitochondria of Chlorophyceae.
Code
AAs = FFLLSSSSYY*LCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (16) | Standard code (1) | |
|---|---|---|---|---|
| TAG | UAG | Leu (L) | STOP = Ter (*) |
Systematic range and comments
Chlorophyceae[1] and the chytridiomycete fungus Spizellomyces punctatus.[2]
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ↑ Y Hayashi-Ishimaru; T Ohama; Y Kawatsu; K Nakamura; S Osawa (June 1996). "UAG is a sense codon in several chlorophycean mitochondria". Current Genetics 30 (1): 29–33. doi:10.1007/s002940050096. PMID 8662206.
- ↑ M. J. Laforest; I. Roewer; B. F. Lang (1 February 1997). "Mitochondrial tRNAs in the lower fungus Spizellomyces punctatus: tRNA editing and UAG 'stop' codons recognized as leucine". Nucleic Acids Research 25 (3): 626–32. doi:10.1093/nar/25.3.626. PMID 9016605.
- ↑ Elzanowski, Andrzej; Ostell, Jim; Leipe, Detlef; Soussov, Vladimir. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. https://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=tgencodes#thetop.
 |  |
